Реферат Курсовая Конспект
Phenotypes - раздел Биология, Мутант имеет лентовидный лист, на котором формируются почки, рецессивная мутация, получена на расе Blanes К-6 Vacuolar H+/ca2+ Transporter; Play A Central Role In Ca2+ And Metal Sequestra...
|
Vacuolar H+/Ca2+ transporter; play a central role in Ca2+ and metal sequestration into the vacuole, localized in the tonoplast; predominately expressed in leaves. Altered plant development: alterations in lateral root growth (seedlings display 11% reduction in primary root length when grown on normal medium, number of lateral roots is reduced by 25%, length of the lateral roots is reduced by almost 50%); alterations in apical dominance (reduced branching, reduced length of the secondary inflorescences); delayed flowering; reduced plant height; eventually plants grow and produce seeds normally. Enhanced growth under Mn2+ and Mg2+ stress conditions; perturbed hormone sensitivities (roots are resistant to auxin but are tolerant to 1-aminocycloproprane-1-carboxylic acid (an ethylene precursor), abscisic acid, and benzyladenine; sensitive to gibberellic acid and epibrassinolide); modestly sensitive to exogenous Ca2+; exhibit a 50% reduction in tonoplast Ca2+/H+ antiport activity, a 40% reduction in tonoplast V-type H+-translocating ATPase activity, a 36% increase in tonoplast Ca2+-ATPase activity; high capacity transporter responsible for maintaining low cytosolic-free Ca2+ concentrations in plant cells by catalyzing pH gradient-energized vacuolar Ca2+ accumulation. Phenotype curated by ABRC.
AT2G34780
Description : Encodes a novel protein of unknown function that is essential for embryonic development. Severe loss of function alleles are embryo lethal. Analysis of a partial loss of function allele indicates a role for EMB1611 in regulation of endoreduplication and maintenance of meristem cell fate. It appears to be required for maintaining the CLV-WUS regulatory pathway.
GO Biological Process : cell division, chromatin silencing, cotyledon development, covalent chromatin modification, determination of bilateral symmetry, embryo development ending in seed dormancy, embryo sac egg cell differentiation, embryonic pattern specification, gene silencing by RNA, leaf development, lipid storage, mRNA export from nucleus, maintenance of meristem identity, meristem initiation, meristem maintenance, meristem structural organization, mitotic recombination, negative regulation of DNA endoreduplication, photomorphogenesis, primary shoot apical meristem specification, protein ubiquitination, regulation of cell cycle process, regulation of cell differentiation, regulation of flower development, response to freezing, seed dormancy process, seed germination, seed maturation, sister chromatid cohesion, sugar mediated signaling pathway, vegetative to reproductive phase transition of meristem
Задание 9. Вы остановились на 2-х ОРС. Как доказать, что одна из них идентична исследуемому гену? Перечислите необходимые этапы работы.
CAPs маркеры
No mispriming library specified
Using 1-based sequence positions
OLIGO start len tm gc% any 3' seq
LEFT PRIMER 121 20 60.08 50.00 4.00 1.00 GCCGGATGATGAAAGTGAGT
RIGHT PRIMER 1022 20 60.41 50.00 6.00 2.00 aagcaaacaggcatgctagg
SEQUENCE SIZE: 1076
INCLUDED REGION SIZE: 1076
PRODUCT SIZE: 902, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 0.00
1 gtctgtgtgtgtgtatgctttgttttggtgtttgtgatatcattactaagcccacaggtg
61 acattttggttttgttgttgtgtagGATTTTGATCCGGTAAGGCATATTTTGGAGAATGT
121 GCCGGATGATGAAAGTGAGTTAGCTTATTTTGAGAAGCAGgtactaacttttaacttctc
>>>>>>>>>>>>>>>>>>>>
181 tcaaggaattgaatataaactgatgcgtctattgtgaaaggttaagaatgttgatgaacg
241 ttttagttagtgagtttaataggttttgtttactgtgtagGCTACCTTGAGGTTGGTACA
301 GCTGGATAAAGTGGCAGAAACTCTGTCTCACCATGTTATGGAGCATCATGAAGTAATGGg
361 taagtattcttgaattgagaagatcatatgcgtttggttttgtgagtattaatatttgct
421 tttggccagTGAAGGGGATGAATTTGGTAAGAGAATTGGAGAAAGATTTGAAGATTGCAA
481 ATGTCATCTGCAAGgtatgagtttcatattcttaacctaaattttacataaacaatacag
541 tggttttattttctattttatctattactggtttgacttggttttggctgtttttgtgtg
601 tttattgccagAATGGAAGACGAAATTTGACTTCTTCTATGAATGAGGCTTCAAGAGATC
661 TTATTGTACACACTCATTCCAAAAAGAAACAAGCTCTTCTGgtaggcttctcaatttatt
721 tcagacatctaggctccactgattgtttctttaatctgctttcttgaaatatttcatgtg
781 ttatagtttccttctgaaatcaccatcaatgtgctctagaactttgtgtacaaaattact
841 ctgtattatcatctatcagaaagtggccgagtatcttttttgttttaatctctaaagtta
901 cgaacaggatgtttctagcaagtagtttcttagatacaatctaagtgtaacctagcctaa
961 ttttttgttttaattgctaaacatactgttgagattattattcctagcatgcctgtttgc
<<<<<<<<<<<<<
1021 ttctctggataccatgtaataagagcgacatgaaagtttaatctttttacttgcag
<
KEYS (in order of precedence):
>>>>>> left primer
<<<<<< right primer
Statistics
con too in in no tm tm high high high
sid many tar excl bad GC too too any 3' poly end
ered Ns get reg GC% clamp low high compl compl X stab ok
Left 2163 0 0 0 1 0 1233 322 0 0 0 19 588
Right 2008 0 0 0 141 0 1360 99 0 3 38 6 361
Pair Stats:
considered 5, ok 5
primer3 release 1.1.4
Fragment Sizes for Cut with XmnI
recognition sequence : GAAnnnnTTC
Sorted Fragment Size (bp)
Fragment Sizes for Cut with BglII
recognition sequence : AGATCT
Sorted Fragment Size (bp)
– Конец работы –
Эта тема принадлежит разделу:
Мутант имеет лентовидный лист на котором формируются почки рецессивная мутация получена на расе Blanes К... Дт... Рецессивная мутация на узких листьях появляются лопасти и новые побеги...
Если Вам нужно дополнительный материал на эту тему, или Вы не нашли то, что искали, рекомендуем воспользоваться поиском по нашей базе работ: Phenotypes
Если этот материал оказался полезным ля Вас, Вы можете сохранить его на свою страничку в социальных сетях:
Твитнуть |
Новости и инфо для студентов